Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1093 
Type of strain Targeted mutant. 
Strain name B6.129-Edg3tm1Jch 
Internal Code SIP3-Knockout 
Submitter ISHII ISAO 
Submitter affiliation or code Showa Pharmaceutical University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization Showa Pharmaceutical University 
Organization code  
Developer Isao Ishii 
Origin
(From other organizations)
Organization The Scripps Research Institute 
Organization code Jch 
Developer Dr. Jerold Chun 
Year introduced April 2005  
Introduced 
Generation
N5+F? 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Edg3 
Gene name endothelial differentiation, sphingolipid G-protein-coupled receptor,3 
Allele symbol Edg3tm1Jch 
Allele name targeted mutation 1, Jerold Chun 
MGI  
Chromosome 13 (13B1 ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Edg3-1(HX1)  ATCGATACCGTCGTCGACCT 
Edg3-2(B3-back)  CACAGCAAGCAGACCTCCAGA 
 

 Reference information
 reference information 1
  Author
Isao Ishii, Beth Friedman, Xiaoqin Ye, Shuji Kawamura, Christine McGiffert, James J. A. Contos, Marcy A. Kingsbury, Guangfa Zhang, Joan Heller Brown, and Jerold Chun  
Title Selective Loss of Sphingosine 1-Phosphate Signaling with No Obvious Phenotypic Abnormality in Mice Lacking Its G Protein-coupled Receptor,LPB3/EDG-3 
Journal J. Biol. Chem. 
Volume 276 
Page 33697-33704 
Year 2001 
PMID  
 
 reference information 2
  Author
Takuwa N, Ohkura S, Takashima S, Ohtani K, Okamoto Y, Tanaka T, et al. 
Title S1P3-mediated cardiac fibrosis in sphingosine kinase 1 transgenic mice involves reactive oxygen species. 
Journal Cardiovasc Res 
Volume 85 
Page 484-493 
Year 2010 
PMID  
 
 reference information 3
  Author
Means CK, Xiao CY, Li Z, Zhang T, Omens JH, Ishii I, et al. 
Title Sphingosine 1-phosphate S1P2 and S1P3 receptor-mediated Akt activation protects against in vivo myocardial ischemia-reperfusion injury. 
Journal Am J Physiol Heart Circ Physiol 
Volume 292 
Page H2944-H2951 
Year 2007 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, Immunology, Development, Physiology