Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1073 
Type of strain Targeted mutant. 
Strain name B6.129-S1pr2tm1Jch 
Internal Code SIP2-Knockout 
Submitter ISHII ISAO 
Submitter affiliation or code Showa Pharmaceutical University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization Showa Pharmaceutical University 
Organization code  
Developer Isao Ishii 
Origin
(From other organizations)
Organization The Scripps Research Institute 
Organization code Jch 
Developer Dr. Jerold Chun 
Year introduced April 2005  
Introduced 
Generation
N5+F? 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
S1pr2 (Synonym: Edg5
Gene name Endothelial differentiation, sphingolipid G-protein-coupled receptor,5 
Allele symbol S1pr2tm1Jch 
Allele name targeted mutation 1, Jerold Chun 
MGI  
Chromosome 9 (6.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Edg5-1(B2-neo)  GCTAAAGCGCATGCTCCAGACT 
Edg5-2(B2-SA)  ACACCCTTTGTATCAAGTGGCAA 
 

 Reference information
 reference information 1
  Author
Isao Ishii, Xiaoqin Ye, Beth Friedman, Shuji Kawamura, James J. A. Contos, Marcy A. Kingsbury, Amy H. Yang, Guangfa Zhang, Joan Heller Brown, and Jerold Chun  
Title Marked Perinatal Lethality and Cellular Signaling Deficits in Mice Null for the Two Sphingosine 1-Phosphate (S1P) Receptors, S1P2/LPB2/EDG-5 and S1P3/LPB3/EDG-3 
Journal J. Biol. Chem. 
Volume 277 
Page 25152-25159 
Year 2002 
PMID  
 
 reference information 2
  Author
Kitada Y, Kajita K, Taguchi K, Mori I, Yamauchi M, Ikeda T, et al. 
Title Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates high-fat diet-induced adipocyte hypertrophy and systemic glucose intolerance in mice. 
Journal Endocrinology 
Volume 157 
Page 1839-1851 
Year 2016 
PMID  
 
 reference information 3
  Author
Akahoshi N, Ishizaki Y, Yasuda H, Murashima YL, Shinba T, Goto K, et al. 
Title Frequent spontaneous seizures followed by spatial working memory/anxiety deficits in mice lacking sphingosine 1-phosphate receptor 2. 
Journal Epilepsy Behav 
Volume 22 
Page 659-665 
Year 2011 
PMID  
 
 reference information 4
  Author
Imasawa T, Koike K, Ishii I, Chun J, Yatomi Y. 
Title Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates streptozotocin-induced apoptosis of pancreatic beta-cells. 
Journal Biochem Biophys Res Commun 
Volume 392 
Page 207-211 
Year 2010 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, Dermatology, Immunology, Development, Physiology