Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2556 
Type of strain Targeted mutant. 
Strain name C57BL/6-Neurod6tm1(cre) 
Internal Code NEX(Neurod6)-cre 
Submitter Esumi Shigeyuki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
If you use NEX(Neurod6)-Cre mouse, please contact to Prof. Klaus-Armin Nave in Max Planck Institute for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Max Planck Institute for Experimental Medicine, Göttingen 
Organization code  
Developer Prof. Klaus-Armin Nave Ph.D. 
Year introduced April 2005  
Introduced 
Generation
10 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Neurod6 
Gene name neurogenic differentiation 6 
Allele symbol Neurod6tm1(cre) 
Allele name neurogenic differentiation 6, targeted mutation 1, 
MGI MGI:106593 
Chromosome 6 (27.53) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Cre F (e26)  tcgatgcaacgagtgatgag 
Cre R (e27)  ttcggctatacgtaacaggg 
 

 Reference information
 reference information 1
  Author
Wu SX, Goebbels S, Nakamura K, Nakamura K, Kometani K, Minato N, Kaneko T, Nave KA, Tamamaki N. 
Title Pyramidal neurons of upper cortical layers generated by NEX-positive progenitor cells in the subventricular zone. 
Journal Proc Natl Acad Sci U S A 
Volume 102(47) 
Page 17172-7 
Year 2005 
PMID  
 
 reference information 2
  Author
Sandra Goebbels, Ingo Bormuth, Ulli Bode, Ola Hermanson, Markus H. Schwab, Klaus-Armin Nave 
Title Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice 
Journal GENESIS 
Volume 44(12) 
Page 611-21 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Hematology, Neurobiology, Cell biology, Molecular biology