Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2361 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Cdh5-CreERT2) 
Internal Code Cdh5-BAC-CreERT2 
Submitter Kubota Yoshiaki 
Submitter affiliation or code School of Medicine, Keio University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization School of Medicine, Keio University 
Organization code  
Developer Yoshiaki Kubota 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cdh5-CreERT2 
Gene name Cdh5-CreERT2 
Allele symbol  
Allele name transgene insertion 
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Cre1  GCGGTCTGGCAGTAAAAACTATC 
Cre2  GTGAAACAGCATTGCTGTCACTT 
 

 Reference information
 reference information 1
  Author
Okabe K, Kobayashi S, Yamada T, Kurihara T, Tai-Nagara I, Miyamoto T, Mukouyama YS, Sato TN, Suda T, Ema M and Kubota Y 
Title Neurons limit angiogenesis by titrating VEGF in retina 
Journal Cell 
Volume 159 
Page 584-596 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Hematology, Neurobiology, Dermatology, cancer, Diabetes, Cell biology, Development, Molecular biology, Anatomy