Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2114 
Type of strain Targeted mutant. 
Strain name C57BL/6-Gsh2,sup>tm1(Flpe) 
Internal Code Gsh2-Flpe knock-in Mouse 
Submitter Esumi Shigeyuki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
If you use Gsh2-Flpe mouse, please contact Dr. Tsutomu Hirata for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer Dr. Tsutomu Hirata 
Year introduced March 2014  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gsh2 
Gene name GS homeobox 2 
Allele symbol Gsh2,sup>tm1(Flpe) 
Allele name GS homeobox 2, targeted mutation 1, 
MGI MGI:95843 
Chromosome 5 (39.55) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Flpe F  CACTGATATTGTAAGTAGTTTGC 
Flpe R  CTAGTGCGAAGTAGTGATCAGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology