Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2112 
Type of strain Targeted mutant. 
Strain name C57BL/6-Sfrp2tm1(CreER-FRT-NEO) 
Internal Code sFRP2-CreER-FRT-NEO knock in Mouse 
Submitter Esumi Shigeyuki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
If you use sFRP2-CreER mouse, please contact Dr. Tsutomu Hirata for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer Dr. Tsutomu Hirata 
Year introduced March 2014  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Sfrp2  
Gene name secreted frizzled-related protein 2 
Allele symbol Sfrp2tm1(CreER-FRT-NEO) 
Allele name secreted frizzled-related protein 2, targeted mutation 1, 
MGI MGI:108078 
Chromosome 3 (37.37) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Cre E26  tcgatgcaacgagtgatgag 
Cre E27  ttcggctatacgtaacaggg 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology