Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
471 
Type of strain Spontaneous/Chemical induced mutant. 
Strain name B6-Tg(HSP70-Crystallin)Tama 
Internal Code H7C 
Submitter Esumi Shigeyuki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Tama 
Developer Nobuaki Tamamaki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Crystallin 
Gene name Crystallin 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Other gene(mutant etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer upper primer  ATGGCAACCGAGGTGAGGCC 
lower primer  CCGAGAAAAGAAATCAGGCA 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Development, Anatomy