Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2851 
Type of strain Spontaneous/Chemical induced mutant.
Targeted mutant. 
Strain name NOD.Cg-Prkdcscid,Hrhr,Jak3tm1 
Internal Code Hairless NOJ 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Division of Hematopoiesis, Joint Research Center for Human Retrovirus Infection, Kumamoto University 
Organization code Card 
Developer Seiji Okada 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Jak3 
Gene name Janus kinase 3 
Allele symbol Jak3tm1 
Allele name Janus kinase 3, targeted mutation 1, 
MGI MGI:99928 
Chromosome 8 (34.43 ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Gene information 2
  Gene symbol
Foxn1 
Gene name forkhead box N1 
Allele symbol Foxn1nu 
Allele name  
MGI MGI:102949 
Chromosome 11 (46.74) 
Gene classification Other gene(mutant etc.) 
Method  
OMIM
 
 Gene information 3
  Gene symbol
Hr 
Gene name lysine demethylase and nuclear receptor corepressor 
Allele symbol Hrhr 
Allele name lysine demethylase and nuclear receptor corepressor 
MGI MGI:96223 
Chromosome 14 (36.32) 
Gene classification Other gene(mutant etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Oligo1  CCA GAC CAG CAG AGG GAC TT  
Oligo2  GAA CCT GCG TGC AAT CCA TCT TG  
Oligo3  ACC CAG GTA CTC CAT GCC CT  
 
 Primer 2
  PCR Primer am05  GCGTTACTGCAGCTAGCTTG 
am06  TGTAGCCTGTGGTCGCATAG 
am07  CTCCTGTTTGCTTGGTCATC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Dermatology, cancer, infectious, Immunology, Cell biology, Laboratory-animal Science, Development, Molecular biology, X ray irradiation, Aging