Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name C57BL/6-C2cd4ctm1(LacZ) 
Internal Code C2cd4c deficient mice(Neo minus) 
Submitter Kume Shoen 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Tokyo Institute of Technology 
Organization code  
Developer Shoen Kume 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name C2 calcium-dependent domain containing 4C 
Allele symbol C2cd4ctm1(LacZ) 
Allele name C2 calcium-dependent domain containing 4C, targeted mutation 1, 
MGI MGI:2685084 
Chromosome 10 (39.72) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
 Primer 1
  PCR Primer C2cd4c forward  gtgctcagcgtgatcctaca 
C2cd4c reverse  ccgaagtcgttccaagaacc 
C2cd4c null  ccacaacgggttcttctgtt 

 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, Diabetes, Obesity, Genetics, Cell biology, Laboratory-animal Science, Development, Molecular biology