Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2336 
Type of strain Targeted mutant. 
Strain name C57BL/6-Plagl1tm1 
Internal Code C57BL/6-Zac1+/-;pat mice 
Submitter Hironori Ueda 
Submitter affiliation or code Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Division of Stem Cell Regulation Research, Graduate School of Medicine, Osaka University 
Organization code  
Developer UEDA, HIRONORI 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Plagl1 
Gene name Pleiomorphic adenoma gene-kike 1 
Allele symbol Plagl1tm1 
Allele name pleiomorphic adenoma gene-like 1, targeted mutation 1 
MGI MGI:1100874 
Chromosome 10 (4.72) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Zac1-flox-F  GGACTCGTCTATAAGAAATGGACAG 
Zac1-F3  ATCCTGATTTAAACACTGAGGGTAG 
Zac1-flox-R  ATGAAGTCGTAACTCACATTGGAAC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Osteosis, Hematology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, peromelia, cancer, Diabetes, Immunology, Genetics, Cell biology, Development, Molecular biology, Aging, Respiratory System