Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2311 
Type of strain Targeted mutant. 
Strain name B6;B6CBF1-Ghtm1168-mut2 
Internal Code 168-mut2 
Submitter Araki Kimi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gh 
Gene name growth hormone 
Allele symbol Ghtm1 
Allele name growth hormone, targeted mutation 1, 
MGI MGI:95707 
Chromosome 11 (68.89) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer GH1-5arm-f7  AGTCCAGATTCCAAACTGCT 
GH1-3arm-r2  AAGAAGGGTGGTCACTGAGG 
GH1-IVS3mut-gtrv  GGGAGAAGGCATCCACTCAT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Endocrine Disorders