Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name B6;CB-Ptf1atm1(EGFP)Card 
Internal Code Ptf1a-EGFP knockin mouse 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Institute of Resource Development and Analysis, Kumamoto University 
Organization code Card 
Developer Ken-ichi Yamamura 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name pancreas specific transcription factor 1a 
Allele symbol Ptf1atm1(EGFP)Card 
Allele name pancreas specific transcription factor, 1a; targeted mutation 1, Center for Animal Resources and Development 
MGI MGI:1328312 
Chromosome 2 (13.37) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer Ptf1a-ex1-s1  agc tcc agc aag cgg gta cta t 
SP-A  cagtgtatatcattgtaacc 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Endocrine Disorders, Diabetes, Laboratory-animal Science