Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1813 
Type of strain Targeted mutant. 
Strain name B6;129-Mll1tm1.1Mlc 
Internal Code MlldC 
Submitter Yokoyama Akihiko 
Submitter affiliation or code Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Stanford University Medical School 
Organization code Mlc 
Developer Michael L. Cleary 
Year introduced May 2009  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Mll1 
Gene name myeloid/lymphoid or mixed-lineage leukemia 1 
Allele symbol Mll1tm1.1Mlc 
Allele name myeloid/lymphoid or mixed-lineage leukemia 1; targeted mutation 1.1, Michael L Cleary 
MGI MGI:96995 
Chromosome 9 (24.84) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer dC&uc.fwd  gttctgaagcacacattccacacc 
dC&uc.rev  catcaaagcgaagggcaatcagtg 
 

 Reference information
 reference information 1
  Author
Yokoyama, A., Ficara, F., Murphy, M. J., Meisel, C., Naresh, A., Kitabayashi, I. and Cleary, M. L.  
Title Proteolytically cleaved MLL subunits are susceptible to distinct degradation pathways. 
Journal J Cell Sci 
Volume 124 
Page 2208-2219 
Year 2011 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Hematology, Endocrine Disorders, cancer, Cell biology, Molecular biology, Aging