Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2198 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Dcx/Katushka)8F 
Internal Code Mouse DCX (mDCX)/Katushka Line 8F 
Submitter Itohara Shigeyoshi 
Submitter affiliation or code Brain Science Institute (BSI), The Institute of Physical and Chemical Research 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Brain Science Institute (BSI), The Institute of Physical and Chemical Research (RIKEN) 
Organization code  
Developer Shigeyoshi Itohara 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
unknown 
Gene name Katushka 1.3 (= TurboFP635) 
Allele symbol Tg(Dcx/Katushka)8F 
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Kat-Int.F  CCTTTATCAACCACACCCAG 
Kat-Int.R  CATCTGGCTATGGCCTCTCAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology