Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2625 
Type of strain Targeted mutant. 
Strain name C57BL/6-M1apem2 
Internal Code M1ap- Ex1crispr 20ins 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
M1ap 
Gene name Meiosis 1 associated protein 
Allele symbol M1apem2 
Allele name Meiosis 1 associated protein, endonuclease-mutation 2, 
MGI MGI:1315200 
Chromosome 6 (35.94) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer M1ap-19439F  ACCTGATCCAATTTTATGAAAGCCAGTC 
M1ap-19851R  CAACTGTGAGTTCTGCTATGGAAATCTC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology