Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Gene trap. 
Strain name B6.Cg-Mark3Gt(Ayu21-T297*mERT2)1Card 
Internal Code Mark3-mERT2,1323 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization IRDA, kumamoto University 
Organization code Card 
Developer Masatake Araki 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name MAP/microtubule affinity-regulating kinase 3 
Allele symbol  
Allele name  
MGI MGI:1341865 
Chromosome 12  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer Cre-1  acatgttcagggatcgccag 
Cre-2  taaccagtgaaacagcattgc 

 Disease , Applicable field information
  Disease name,
Applicable field