Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2248 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(CAG-LSL-Spink3)10Card 
Internal Code CAG promoter-LSL-Spink3 line 10 
Submitter Ohmuraya Masaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Spink3 
Gene name Serine protease inhibitor, Kazal type 3 
Allele symbol  
Allele name  
MGI MGI:106202 
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer mPsti5  TGTGTGGGACTGACGGAATTAC 
mPsti6  AGGACAGGCTCTATGCGTTTC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders