|
CARD ID
 |
2073 |
Type of strain |
Transgenic. |
Strain name |
C57BL/6-Tg(CAG-lox-mRFP-lox-GFP)18-43Tama |
Internal Code |
CAG-lox-mRFP-lox GFP double reporter mouse |
Submitter |
Esumi Shigeyuki |
Submitter affiliation or code |
- |
Stock Type |
|
Material Transfer Conditions |
No condition. |
Production method |
In-house breading. |
Origin (In-house) |
Organization |
Dept of Morphological Neural Science. Grad Sch of Medical Sciences, Kumamoto Univ. |
Organization code |
Tama |
Developer |
Nobuaki Tamamaki |
Origin (From other organizations) |
Organization |
|
Organization code |
|
Developer |
|
Year introduced |
|
Introduced Generation |
|
Remarks |
This mice keep homozygote. |
|
Gene symbol
 |
GFP |
Gene name |
Green fluorescent protein |
Allele symbol |
(CAG-lox-mRFP-lox-GFP) |
Allele name |
transgene insertion, Nobuaki Tamamaki, Department of Morphological Brain Science, Graduate School of Medicine, Kyoto University |
MGI |
|
Chromosome |
|
Gene classification |
Gene to express(transgenic) |
Method |
MicroInjection |
OMIM |
|
|
|
PCR Primer |
CGGCAAGCTGACCCTGAAG
|
CTTGTGCCCCAGGATGTTGC
|
|
reference information 1 |
|
Author
 |
Tanahira C, Higo S, Watanabe K, Tomioka R, Ebihara S, Kaneko T, Tamamaki N. |
Title |
Parvalbumin neurons in the forebrain as revealed by parvalbumin-Cre transgenic mice. |
Journal |
Neurosci Res. |
Volume |
Mar;63(3) |
Page |
213-23 |
Year |
2009 |
PMID
|
|
|
Disease , Applicable field information
|
|
Disease name, Applicable field
|
Ophthalomology, Osteosis, Dentistry, Otorhinology, Hematology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology, Aging, Anatomy
|
|
|