Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2628 
Type of strain Transgenic. 
Strain name C57BL/6NJcl-Tg(3LTR-GFP-Enh) 
Internal Code HBZ_Prom_GFP_Enh 
Submitter Satou Yorifumi  
Submitter affiliation or code Center for AIDS Research, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Center for AIDS Research,Kumamoto University 
Organization code  
Developer Yorifumi Satou 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
EGFP 
Gene name Enhanced Green Fluorescent Protein 
Allele symbol  
Allele name  
MGI  
Chromosome 6 (qE3 ) 
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer mouse-En2-intron-F  TTGGGATCCCTGCAGGTC 
HindIII-3LTR300-reviseR  AAGCTTGCGTCCGCCGTCTAGGTAAGTT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown