Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1203 
Type of strain Targeted mutant. 
Strain name B6;129Sv-Ednrbtm1 
Internal Code Ednrb-floxed 
Submitter Kato Masashi 
Submitter affiliation or code Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization University of Wisconsin 
Organization code  
Developer Jeffery W. Walker 
Year introduced March 2008  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ednrb 
Gene name endothelin receptor type B 
Allele symbol Ednrbtm1 
Allele name targeted mutation 1 
MGI MGI:102720 
Chromosome 14 (51.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer EdnrB-FL-F  TGGAATGTGTGCGAGGCC 
EdnrB-FL-R  CAGCCAGAACCACAGAGACCACCC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Dermatology, cancer, Development, Physiology