Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1134 
Type of strain Gene trap. 
Strain name B6;CB-Echdc2Gt(pU-21T)490Imeg 
Internal Code Ayu21-T490 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code  
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Echdc2 
Gene name enoyl Coenzyme A hydratase domain containing 2 
Allele symbol  
Allele name  
MGI MGI:1289238 
Chromosome 4  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0006631 fatty acid metabolic process IEA
GO:0016829 lyase activity IEA
GO:0005739 mitochondrion IEA
GO:0006629 lipid metabolic process IEA
GO:0003824 catalytic activity IEA
GO:0008152 metabolic process IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0006631 fatty acid metabolic process IEA
GO:0016829 lyase activity IEA
GO:0005739 mitochondrion IEA
GO:0006629 lipid metabolic process IEA
GO:0003824 catalytic activity IEA
GO:0008152 metabolic process IEA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-T490