Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1840 
Type of strain Targeted mutant. 
Strain name B6;129-Clk1tm1 
Internal Code clk1 knockout mouse 
Submitter Ono Tetsuya 
Submitter affiliation or code Department of Cell Biology, Tohoku University School of Medicine  
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Clk1 
Gene name CDC-like kinase 1 
Allele symbol Clk1tm1 
Allele name targeted mutation 1 
MGI MGI:107403 
Chromosome 1 (29.09) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer clk (wt)  5' TGTCTCAAACAAAACAAACCAA 3' 
clk (com)  5' TTTCCCTGCCTTCTGACCTGT 3' 
 
 Primer 2
  PCR Primer clk (mut)  5' GCCTCTGTTCCACATACACTTCATT 3' 
clk (com)  5' TTTCCCTGCCTTCTGACCTGT 3' 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Aging