Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1749 
Type of strain Gene trap. 
Strain name B6; CB-Fzr1GT(pU-17)Tgen 
Internal Code Fzr1/Cdh1(GT) 
Submitter Saya Hideyuki 
Submitter affiliation or code Division of Gene Regulation, Institute for Advanced Medical Research,Keio University School of Medicine 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization TransGenic, Inc 
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fzr1 
Gene name fizzy/cell division cycle 20 related 1 (Drosophila) 
Allele symbol  
Allele name  
MGI MGI:1926790 
Chromosome 10  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Gs4  CCTCCACTACAGCAGCACG 
Gas7, SA6as  CTCCAAGGCCTTTGTGAGGC, CCGGCTAAAACTTGAGACCTTC 
 

 Reference information
 reference information 1
  Author
Naoe H, Araki K, Nagano O, Kobayashi Y, Ishizawa J, Chiyoda T, Shimizu T, Sasaki Y, Yamamura KI, Saya H, Kuninaka S 
Title The anaphase-promoting complex/cyclosome activator Cdh1 modulates RhoGTPase by targeting p190 RhoGAP for degradation. 
Journal Mol. Cell. Biol. 
Volume 30 
Page 3994-4005 
Year 2010 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, cancer, Development, Molecular biology, Aging