Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
608 
Type of strain Targeted mutant. 
Strain name B6;CB-G5prtm1LrsnImku 
Internal Code G5pr-flox
B6;CB-G5prtm1LrsnImku 
Submitter Nobuo SAKAGUCHI 
Submitter affiliation or code Kumamoto University School of Medicine, Department of Immunoloy 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Department of Immunology, Kumamoto University 
Organization code Imuk 
Developer Nobuo Sakaguchi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
AJ238247 (Genebank accession #) 
Gene name g5Pr 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer G1  GAGGGGCCATGGAAATGCAGCATAAACA 
G2  TCGCAGCTCACCAAGCCGGATTTCTAAAGG 
 

 Reference information
 reference information 1
  Author
Yan Xing, Hideya Igarashi, Xiaodan Wang, and Nobuo Sakaguchi 
Title Protein phosphatase subunit G5PR is needed for inhibition of B cell receptor-induced apoptosis 
Journal The Journal of Experimental Medicine 
Volume 202 
Page 707-719 
Year 2005 
PMID 16129705  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Immunology