Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
555 
Type of strain Targeted mutant. 
Strain name B6.CBA-Ahctf1tm2 
Internal Code
B6.CBA-Ahctf1tm2 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kumamoto University 
Organization code Unknown 
Developer Keisuke Okita 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ahctf1(old symbol:Elys) 
Gene name AT hook containing transciption factor 1 
Allele symbol Ahctf1tm2 
Allele name targeted mutation 2 
MGI  
Chromosome 1 (102) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM OMIM ID: 610853
Human Gene Symbol: AHCTF1

 
 Primer 1
  PCR Primer Neo Seq R  CTTCCTCGTGCTTTACGGTA 
KOP2g6F  ACCACTTTATTCCATGTCCAC 
 

 Reference information
 reference information 1
  Author
Keisuke Okita, Hiroshi Kiyonari, Ikuo Nobuhisa, Naoki Kimura, Shinichi Aizawa and Tetsuya Taga 
Title Targeted disruption of the mouse ELYS gene results in embryonic death at peri-implantation development 
Journal Genes to Cells 
Volume
Page 1083-1091 
Year 2004 
PMID 15507119  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 610853
Human Gene Symbol: AHCTF1