Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes 
 Strain information
  CARD ID
2072 
Type of strain Transgenic. 
Strain name STOCK-Tg(CAG-Alk3) 
Internal Code caAlk3 
Submitter Yamada Gen 
Submitter affiliation or code Department of Developmental Genetics Research, Wakayama Medical University (WMU) 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Alk3 
Gene name Activin receptor-like kinase 3 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer lac1  TCGGCGGTGAAATTATCGATGAGC 
lac3  CCACAGCGGATGGTTCGGATAATGC