Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2881 
Type of strain Targeted mutant. 
Strain name C57BL/6-Sycp2em1 
Internal Code SYCP2-Line#17 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Sycp2 
Gene name synaptonemal complex protein 2 
Allele symbol Sycp2em1 
Allele name synaptonemal complex protein 2; endonuclease-mediated mutation 1, 
MGI MGI:1933281 
Chromosome 2 (99.81) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer SYCP2-F1  ATGTATACCTAGAAATGGAACTACATG 
SYCP2-R1  CAAAGTATGAAGGTACTAACAATTAAAG 
SYCP2-R2  ATACTTGGAGGTCTGGTCTCACTGGC 
 

 Reference information
 reference information 1
  Author
Fujiwara Y., Horisawa-Takada Y., Inoue E., Tani N., Shibuya H., Fujimura S., Kariyazono R., Sakata T., Ohta K., Araki K., Okada Y., Ishiguro K. 
Title Meiotic cohesins mediate initial loading of HORMAD1 to the chromosomes and coordinate SC formation during meiotic prophase.  
Journal PLOS Genetics  
Volume  
Page  
Year 2020 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology