Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2858 
Type of strain Targeted mutant. 
Strain name C57BL/6-Zfp541em1 
Internal Code ZFP541-Line#17 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Zfp541 
Gene name zinc finger protein 541 
Allele symbol Zfp541em1 
Allele name  
MGI MGI:3647699 
Chromosome 7 (8.74) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer ZFP541-F1  agctagctgccagcgagggctcttc 
ZFP541-R2  tggttgagtgtgtcactgcagttgag 
ZFP541-R3  gaggcagcagaagggaggtaggatg 
 

 Reference information
 reference information 1
  Author
Horisawa-Takada Y, Kodera C, Takemoto K, Sakashita A, Horisawa K, Maeda R, Usuki S, Fujimura S, Tani N, Matsuura K, Shimada R, Akiyama T, Suzuki A, Niwa H, Tachibana M, Ohba T, Katabuchi H, Namekawa S, Araki K, Ishiguro K 
Title Meiosis-specific ZFP541 repressor complex promotes developmental progression of meiotic prophase towards completion during mouse spermatogenesis 
Journal Nature Communications 
Volume In press 
Page  
Year 2021 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology