Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2778 
Type of strain Targeted mutant. 
Strain name C57BL/6-Gm6653em1 
Internal Code Gm6653-Line#16 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gm6653 
Gene name predicted gene 6653 
Allele symbol Gm6653em1 
Allele name predicted gene 6653, endonuclease-mediated mutation 1, 
MGI MGI:3647484 
Chromosome 10 (43.70) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Gm6653_genotype_F  CTAACAACGAAGATTCGCTTGCTGG 
Gm6653_genotype_R2  CTGAATAGTCCACTTACATAGGGGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology