Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2743 
Type of strain Targeted mutant. 
Strain name C57BL/6-Meiosinem1 
Internal Code Gm4969 (del6-14) crispr-ssODN#26 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gm4969(Meiosin) 
Gene name predicted gene 4969 
Allele symbol Meiosinem1 
Allele name predicted gene 4969, endonuclease-mediated mutation 1, 
MGI MGI:3647482 
Chromosome 7 (9.46) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Gm4969-29909R  gggTGTCAAAGTATAGAAGCAAAATGC 
Gm4969-22787F  AAGAAGAAGTTTACCCGAGTGTCAG 
Gm4969-29605F  CCAGAGAGGAAATGTATTTACTGATCC 
 

 Reference information
 reference information 1
  Author
Ishiguro K, Matsuura K, Tani N, Takeda N, Usuki S, Yamane M, Sugimoto M, Fujimura S, Hosokawa M, Chuma S, Ko S.H.M, Araki K, Niwa H. 
Title MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells. 
Journal Dev. Cell 
Volume 52(4) 
Page 429-445 
Year 2020 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology