Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2642 
Type of strain Targeted mutant. 
Strain name C57BL/6-Meikintm1 
Internal Code Meikin Ex6 (+/-) 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kei-ichiro Ishiguro 
Organization code  
Developer Institute of Molecular Embryology and Genetics, Kumamoto University 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Meikin 
Gene name meiotic kinetochore factor 
Allele symbol Meikintm1 
Allele name meiotic kinetochore factor; targeted mutation 1, 
MGI MGI:1922097 
Chromosome 11 (32.13) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Ex3F (common-forward)  CCCCAGAGGAAAAGACACCACC 
Ex4R (wild-type-reverse)  CTCGACAACAAGCTGTCCATCTC 
 
 Primer 2
  PCR Primer Ex3F (common-forward)  CCCCAGAGGAAAAGACACCACC 
Neo4R (mutant-reverse)  CATGAGTGGGAGGAATGAGCTGGC 
 

 Reference information
 reference information 1
  Author
Kim J, Ishiguro K., Nambu A., Akiyoshi B., Yokobayashi S., Kagami A., Ishiguro T., Pendas A.M., Takeda N., Sakakibara Y., Kitajima T.S., Tanno Y., Sakuno T., Watanabe Y. 
Title Meikin is a conserved regulator of meiosis-I-specific kinetochore function 
Journal Nature 
Volume 517 
Page 466-471 
Year 2015 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology, Development, Molecular biology