Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2378 
Type of strain Targeted mutant. 
Strain name B6;129-Triml1tm1Miya 
Internal Code Triml1 KO 
Submitter Miyazaki Jun-ichi 
Submitter affiliation or code Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Miya 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Triml1 
Gene name tripartite motif family-like 1 
Allele symbol Triml1tm1Miya 
Allele name tripartite motif family-like 1, targeted mutation 1, 
MGI MGI:2687279 
Chromosome 8 (8A4 , 23.89) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Cue320-seq3-F  AGTGTCAATTCATTGTGCGTC 
Cue320-WT-allele-R  TCTACCCTGAGCATCTGAGAGACTC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Development