Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2338 
Type of strain Targeted mutant. 
Strain name B6;129-Gtsf1tm1Miya 
Internal Code Gtsf1 KO 
Submitter Miyazaki Jun-ichi 
Submitter affiliation or code Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Miya 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gtsf1 
Gene name Gametocyte specific factor 1 
Allele symbol Gtsf1tm1Miya 
Allele name Gametocyte specific factor 1, targeted mutation 1, 
MGI MGI:1921424 
Chromosome 15 (15F3 , 58.93) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer 110EX4A3  TGTTTGTTTGTTTTCATGACAGGGTTTC 
Puro-S4  ACCCGCAAGCCCGGTGCCTGA 
110INT3S3  GGGGCACTGTAATAACTTTTCAGGGTCC 
 

 Reference information
 reference information 1
  Author
Yoshimura T, Toyoda S, Kuramochi-Miyagawa S, Miyazaki T, Miyazaki S, Tashiro F, Yamato E, Nakano T, Miyazaki J 
Title Gtsf1/Cue110, a gene encoding a protein with two copies of a CHHC Zn-finger motif, is involved in spermatogenesis and retrotransposon suppression in murine testes 
Journal Developmental Biology 
Volume 335 
Page 216-227 
Year 2009 
PMID  
 
 reference information 2
  Author
Yoshimura T, Miyazaki T, Toyoda S, Miyazaki S, Tashiro F, Yamato E, Miyazaki J 
Title Gene expression pattern of Cue110: A member of the uncharacterized UPF0224 gene family preferentially expressed in germ cells 
Journal Gene Expression Patterns 
Volume
Page 27-35 
Year 2007 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Development