Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2781 
Type of strain Targeted mutant. 
Strain name C57BL/6-Nfatc1tm1 
Internal Code Nfatc1 variant 3 exon1-specific knockout mice53c 
Submitter Mimura Toshihide  
Submitter affiliation or code Department of Rheumatology and Applied Immunology,Faculty of Medicine, Saitama Medical University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced July 2015  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Nfatc1 
Gene name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 
Allele symbol Nfatc1tm1 
Allele name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1; targeted mutation 1, 
MGI MGI:102469 
Chromosome 18 (53.66) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer target_S  TCCAGTCCCTTCCAAGTTTCCACTC 
target_R  TCTGGGCTGCGCCGGGGAAACAC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Osteosis, Immunology