Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2676 
Type of strain Targeted mutant. 
Strain name C57BL/6-Creb3l1tm1 
Internal Code Oasis KO 
Submitter Araki Kimi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Creb3l1 
Gene name cAMP responsive element binding protein 3-like 1 
Allele symbol Creb3l1tm1 
Allele name cAMP responsive element binding protein 3-like 1, targeted mutation 1, 
MGI MGI:1347062 
Chromosome 2 (50.63) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Oasis-gf1  AGAGGTGCCCATCACAGCAGCA 
Oasis-gr1  CTTGAGCACTTTCCCATCTTAC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Osteosis