Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2251 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(CAG-LSL-p62)139Card 
Internal Code CAG promoter-LSL-p62 line 139 
Submitter Ohmuraya Masaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Resource Development and Analysis, Kumamoto University 
Organization code Card 
Developer Masaki Ohmuraya 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Sqstm1 
Gene name sequestosome 1 
Allele symbol  
Allele name  
MGI MGI:107931 
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer p62-F2  gctgccctatacccacatct 
Ag4  accaccttctgataggcag 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Osteosis, Digestive Disorders, cancer, Laboratory-animal Science