Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
708 
Type of strain Transgenic. 
Strain name B6;C3H-Tg(RIP-Ptgs2/RIP-Ptges) 
Internal Code B6;C3H-Tg(RIP-Ptgs2/RIP-Ptges), RIP-C2mE 
Submitter Masanobu Oshima 
Submitter affiliation or code Division of Genetics, Cancer Research Institute, Kanazawa University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Cancer Research Institute, Kanazawa University 
Organization code  
Developer Hiroko Oshima 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ptges (synonym:PmGES-1) 
Gene name Ptges:prostaglandin E synthase 
Allele symbol  
Allele name  
MGI MGI:1927593 
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 600262
Human Gene Symbol: PTGS2

OMIM ID: 605172
Human Gene Symbol: PTGES

 
 Gene information 2
  Gene symbol
Ptgs2 (synonym:COX-2) 
Gene name prostaglandin-endoperoxide synthase 2 
Allele symbol  
Allele name  
MGI MGI:97798 
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer COX-2-F3  CAAACTCAAGTTTGACCCAG 
COX-2-R1  CTTTTACAGCTCAGTTGAACG 
 

 Reference information
 reference information 1
  Author
Hiroko Oshima, Makoto Mark Taketo, and Masanobu Oshima 
Title Destruction of Pancreatic β-Cells by Transgenic Induction of Prostaglandin E2 in the Islets 
Journal J. Biol. Chem. 
Volume 281 
Page 29330-29336 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Physiology, Unknown 
  OMIM OMIM ID: 600262
Human Gene Symbol: PTGS2

OMIM ID: 605172
Human Gene Symbol: PTGES