Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1979 
Type of strain Targeted mutant. 
Strain name B6.Cg-Atpif1tm1 
Internal Code Atpif1 KO 
Submitter Masasuke Yoshida 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions Other conditions. 
1;In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (will be announced). 2;Within a period of 3 years after deposition of the material, user must contact bailor and notify him a content of the research. If the bailor judges that the research should be a collaborative work, then user must include bailor and/or developer's names as co-authors. 
Production method In-house breading.
 
Origin
(In-house)
Organization Department of Molecular Bioscience, Kyoto Sangyo University 
Organization code  
Developer Yoshida Masasuke 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Atpif1 
Gene name ATPase inhibitory factor 1 
Allele symbol Atpif1tm1 
Allele name ATPase inhibitory factor 1, targeted mutation 1, Masasuke Yoshida, Kyoto Sangyo University 
MGI  
Chromosome 4 (65.51 ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Atpif1-For1  GTGCATGTGCACTTTTGTGTGTGTGTATGC 
Atpif1-Rev1  ACACAGCAGCTCACAAGCACATGTAACTGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, cancer, Unknown