Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1049 
Type of strain Targeted mutant. 
Strain name B6.129-Hspa4tm1 
Internal Code APG2 KO 
Submitter Teranishi Yutaka 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions In the following cases, you do not need to be in contact. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Dep of Clin Mol Biol, Faculty of Medicine, Kyoto University 
Organization code  
Developer Jun Fujita 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hspa4 
Gene name heat shock protein 4 
Allele symbol Hspa4tm1 
Allele name heat shock protein 4, targeted mutation 1 
MGI MGI:1342292 
Chromosome 11 (29.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer OP4169  5'ctgctaaagcgcatgctccaga3' 
OP4142  5'ctcgtctgatcacgggaagtgag3' 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown