Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name B6.129-Cirbptm1 
Internal Code CIRP KO 
Submitter Teranishi Yutaka 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Dep of Clin Mol Biol, Faculty of Med, Kyoto University 
Organization code  
Developer Jun Fujita 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name cold inducible RNA binding protein 
Allele symbol Cirbptm1 
Allele name cold inducible RNA binding protein, targeted mutation 1 
MGI MGI:893588 
Chromosome 10 (44.0) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer OP4170  5'gcccagaaagcgaaggagcaaag3' 
OP4240  5'gcttcgtgaagccaaagaaactgcgtaca3' 

 Disease , Applicable field information
  Disease name,
Applicable field