Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2277 
Type of strain Transgenic. 
Strain name C57B6/6-Tg(CAG-GFP-Dcp1a)29Nrs 
Internal Code B6.Tg(GFPDcp1a)#29Nrs 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
In publishing the research results obtained by use of the CARD, a citation of the literature designated by the DEPOSITOR is requested. 
Production method In-house breading.
 
Origin
(In-house)
Organization National Institute of Radiological Sciences 
Organization code  
Developer Yonekura Yoshiharu 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Dcp1a 
Gene name decapping mRNA 1A 
Allele symbol  
Allele name  
MGI  
Chromosome 1  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer TgCheckChr1F278  GCTTTTTGTTTGTTTGGTAGGG 
TgCheckChr1R734  GCATAATAGCCAAGACATGCAA 
CAGpromoterR109  GGCGGGCCATTTACCGTAAGTTATGT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Endocrine Disorders, Neurobiology, infectious, Cell biology, Development, Molecular biology