Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2253 
Type of strain Targeted mutant. 
Strain name C57BL/6-Choptm1 
Internal Code Chop KO 
Submitter Oike Yuich 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Osaka University 
Organization code  
Developer Shizuo Akira 
Year introduced April 2000  
Introduced 
Generation
20 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ddit3 
Gene name DNA-damage inducible transcript 3 
Allele symbol Ddit3tm1 
Allele name DNA-damage inducible transcript 3, targeted mutation 1, 
MGI MGI:109247 
Chromosome 10 (10 D3 , 74.50) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer sCHOP1  cctggattaagcttggtagt 
aCHOP5  ggacgcagggtcaagagtag 
neo-F  agaggctattcggctatgac 
neo-R  gcttgccgaatatcatggtg 
 

 Reference information
 reference information 1
  Author
S. Oyadomari, A. Koizumi, K. Takeda, T. Gotoh, S. Akira, E. Araki & M. Mori.  
Title A targeted disruption of the CHOP gene protects mice against ER stress-induced diabetes.  
Journal J. Clin. Invest.  
Volume 109 
Page 525-532 
Year 2002 
PMID  
 
 reference information 2
  Author
H. Tsukano, T. Gotoh*, M. Endo, K. Miyata, H. Tazume, T. Kadomatsu, M. Yano, T. Iwawaki, K. Kohno, K. Araki, H. Mizuta & Y. Oike.  
Title The Endoplasmic Reticulum Stress-CHOP Pathway-mediated Apoptosis in Macrophages Contributes to the Instability of Atherosclerotic Plaques. 
Journal Arterioscler. Thromb. Vasc. Biol., 
Volume 30 
Page 1925-1932 
Year 2010 
PMID  
 
 reference information 3
  Author
Y. Miyazaki, K. Kaikita, M. Endo, E. Horio, M. Miura, K. Tsujita, S. Hokimoto, M. Yamamoto, T. Iwawaki, T. Gotoh, H. Ogawa & Y. Oike. 
Title C/EBP homologous protein deficiency attenuates myocardial reperfusion injury by inhibiting myocardial apoptosis and inflammation. 
Journal Arterioscler. Thromb. Vasc. Biol., 
Volume 31 
Page 1124-1132 
Year 2011 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Hematology, Metabolism, Neurobiology, infectious, Diabetes, Cell biology