Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2188 
Type of strain Targeted mutant. 
Strain name C57BL/6-Dbx1tm1(Cre/ERT2) 
Internal Code Dbx1-CreER knock in Mouse 
Submitter Esumi Shigeyuki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
If you use Dbx1-CreER mouse, please contact Dr. Tsutomu Hirata and Dr.Joshua Corbin for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer Dr. Tsutomu Hirata 
Year introduced March 2014  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Dbx1 
Gene name developing brain homeobox 1 
Allele symbol Dbx1tm1(Cre/ERT2) 
Allele name developing brain homeobox 1, targeted mutation 1, 
MGI MGI:94867 
Chromosome 7 (31.44) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Cre F  GCGGTCTGGCAGTAAAAACTATC 
Cre R  GTGAAACAGCATTGCTGTCACTT 
 

 Reference information
 reference information 1
  Author
Hirata T, Li P, Lanuza GM, Cocas LA, Huntsman MM, Corbin JG. 
Title Identification of distinct telencephalic progenitor pools for neuronal diversity in the amygdala. 
Journal Nature Neuroscience 
Volume 2009  
Page 141-149 
Year Feb;12(2): 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology