Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1883 
Type of strain Targeted mutant. 
Strain name B6;CB-Gt(pU-21B)210Imegtm1(CAG-SPINK1)Card 
Internal Code B210-CAG-SPINK1 knockin mouse 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Center for Animal Resources & Development (CARD), Kumamoto University 
Organization code Card 
Developer Ken-ichi Yamamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Diap2 
Gene name Drosophila inhibitor of apoptosis 2 
Allele symbol Gt(Ayu21-B)137Imegtm1.1(CAG-SPINK1)46Card 
Allele name Gt(pU-21B)210Imeg, targeted mutation 1, Naomi Nakagata Center for Animal Resources & Development  
MGI  
Chromosome X (52.36) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer SPINK1-1-1  gaaggtaacaggcatctttcttctc 
SPINK1-1-2  atctctttacctctcttcccaggg 
 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer