Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
790 
Type of strain Targeted mutant. 
Strain name B6;129-Ddit3tm1Aki 
Internal Code Chop homo-/- 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Dept. of Host Defense Res. Inst. for Microbial Dis. Osaka Univ. 
Organization code Aki 
Developer Shizuo Akira 
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ddit3 
Gene name DNA-damage inducible transcript 3 
Allele symbol Ddit3tm1Aki 
Allele name DNA-damage inducible transcript 3; targeted mutation 1, Shizuo Akira 
MGI MGI:109247 
Chromosome 10 (D3 , 126727830-126733342 (+)) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Chop sense  GAGAAAAAAAGAGTACAAATGGCCTGG 
Chop antisense -NEO  ATCGCCTTCTATCGCCTTCTTGACGAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Immunology