Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2776 
Type of strain Targeted mutant. 
Strain name C57BL/6-4930432K21Rikem2 
Internal Code 4930432K21Rik- Line #6 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
4930432K21Rik 
Gene name RIKEN cDNA 4930432K21 gene 
Allele symbol 4930432K21Rikem2 
Allele name RIKEN cDNA 4930432K21 gene; endonuclease-mediated mutation 2, 
MGI MGI:1921916 
Chromosome 8 (40.35) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer 4930432K21Rik-1F  TGTTCACACAAAGTTCTTGAATCAG 
4930432K21Rik-3R   TCTGTGTGAGAATTGAGGCCTAAGC 
4930432K21Rik-2R  GAGGTAAAGGGTTTGAGTTCAGACC 
 

 Reference information
 reference information 1
  Author
Kazumasa Takemoto, Naoki Tani, Yuki Takada-Horisawa, Sayoko Fujimura, Nobuhiro Tanno, Mariko Yamane, Kaho Okamura, Michihiko Sugimoto, Kimi Araki, Kei-ichiro Ishiguro. 
Title A meiosis-specific factor C19orf57/4930432K21Rik/BRME1 modulates localization of RAD51 and DMC1 recombinases to DSBs in mouse meiotic recombination. 
Journal Cell Reports 
Volume  
Page  
Year 2020.02.14 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology