Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2768 
Type of strain Targeted mutant. 
Strain name C57BL/6-Nrn1tm1 Vgftm1813 
Internal Code Nrn1 +/-; Vgf +/- (#813) 
Submitter Shimamura Kenji 
Submitter affiliation or code Institute for Molecular Embryology and Genetics, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kumamoto university 
Organization code  
Developer Kenji Shimamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Nrn1 
Gene name Neuritin-1 
Allele symbol Nrn1tm1 
Allele name Neuritin-1; targeted mutation 1, 
MGI MGI:1915654 
Chromosome 13 (14.44) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Gene information 2
  Gene symbol
Vgf 
Gene name VGF nerve growth factor inducible 
Allele symbol Vgftm1 
Allele name VGF nerve growth factor inducible; targeted mutation 1, 
MGI MGI:1343180 
Chromosome 5 (76.13) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Nrn1_GenomeSeq_FW1  ACCAGGGAACTGAGCCTGAG 
Nrn1_GenomeSeq_RV1  GGACTCACCTCCCTGCTATC 
 
 Primer 2
  PCR Primer Vgf_GenomeSeq_FW1  GGTACCCAGAAGGAGGATTG 
Vgf_GenomeSeq_RV2  TTGCTCGGACTGAAATCTCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology