Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
780 
Type of strain Transgenic. 
Strain name B6;C3H-Tg(K19-Wnt1)#7S 
Internal Code K19-Wnt1 
Submitter Masanobu Oshima 
Submitter affiliation or code Division of Genetics, Cancer Research Institute, Kanazawa University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Cancer Research Institute, Kanazawa Univ. 
Organization code  
Developer Hiroko Oshima 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Wnt1 
Gene name wingless-related MMTV integration site 1 
Allele symbol  
Allele name  
MGI MGI:98953 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
GO
GO ID GO Term GO Evidence Code
GO:0005576 extracellular region IEA
GO:0007275 multicellular organismal development IEA
GO:0005578 proteinaceous extracellular matrix IEA
GO:0007223 Wnt receptor signaling pathway, calcium modulating pathway IEA
GO:0004871 signal transducer activity IEA
GO:0022004 midbrain-hindbrain boundary maturation during brain development IMP
GO:0021536 diencephalon development IGI
GO:0021797 forebrain anterior/posterior pattern formation IGI
GO:0010552 positive regulation of gene-specific transcription from RNA polymerase II promoter IDA
GO:0060070 Wnt receptor signaling pathway through beta-catenin IDA
more... (Total Hit Count: 19)
OMIM OMIM ID: 164820
Human Gene Symbol: WNT1

GO
GO ID GO Term GO Evidence Code
GO:0005576 extracellular region IEA
GO:0007275 multicellular organismal development IEA
GO:0005578 proteinaceous extracellular matrix IEA
GO:0007223 Wnt receptor signaling pathway, calcium modulating pathway IEA
GO:0004871 signal transducer activity IEA
GO:0022004 midbrain-hindbrain boundary maturation during brain development IMP
GO:0021536 diencephalon development IGI
GO:0021797 forebrain anterior/posterior pattern formation IGI
GO:0010552 positive regulation of gene-specific transcription from RNA polymerase II promoter IDA
GO:0060070 Wnt receptor signaling pathway through beta-catenin IDA
more... (Total Hit Count: 19)
 
 Primer 1
  PCR Primer Wnt1F  CGACCGTGTTCTCTGAGATG 
HA-R  CATCATATGGGTAGGCCATGG 
 

 Reference information
 reference information 1
  Author
Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M. 
Title Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway. 
Journal Gastroenterology 
Volume 131 
Page 1086-1095 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
cancer 
  OMIM OMIM ID: 164820
Human Gene Symbol: WNT1