Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2992 
Type of strain Targeted mutant. 
Strain name C57BL/6J-Wnt2bem2Cre/ERT2) 
Internal Code Wnt2b-2A-CreERT2 (No.36) 
Submitter Takahashi Masanori 
Submitter affiliation or code Center for Molecular Medicine, Jichi Medical University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Jichi Medical University 
Organization code  
Developer Masanori Takahashi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Wnt2b 
Gene name wingless-type MMTV integration site family, member 2B 
Allele symbol Wnt2bem2Cre/ERT2)  
Allele name wingless-type MMTV integration site family, member 2B; endonuclease-mediated mutation 2, 
MGI MGI:1261834 
Chromosome 3 (45.88) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Wnt2b screening 5Fw (28 mer)   TTAATCTCAGTTTGGCCCCCATTGTACT 
Cre Tm68 R2 (28 mer)   CTTTTGCAAGGAATGCGATGAAGTAGAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development